You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yhdR [2018-09-06 18:20:06]
similar to aspartate aminotransferase
Molecular weight
43.73 kDa
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
1,034,046 → 1,035,227
The protein
Catalyzed reaction/ biological activity
L-aspartate + 2-oxoglutarate = oxaloacetate + L-glutamate (according to Swiss-Prot)Protein family
class-I pyridoxal-phosphate-dependent aminotransferase family (according to Swiss-Prot)Structure
3ELE (from Eubacterium rectale, 34% identity) Localization
cytoplasm (according to Swiss-Prot)Additional information
The gene is annotated in KEGG as aspartate aminotransferase EC 2.6.1.1. In MetaCyc the protein is marked as “similar to aspartate aminotransferase”. No EC annotation is available in Swiss-Prot. No literature/experimental evidence supporting the annotation is availablavailable. PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B485 (yhdR::erm), available at the NBRP B. subtilis, JapanBKE09570 (ΔyhdR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAABKK09570 (ΔyhdR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTGTCCCTTCCGCATAT, downstream forward: _UP4_TAAGAAGGCAAAGAAAAGAA